A framework for extremely multiplexed dextramer mapping and prediction of T cell receptor sequences to antigen specificity

T cell receptor (TCR) antigen-specific recognition is important for the adaptive immune system. Nevertheless, constructing a TCR-antigen interplay map has been difficult because of the staggering range of TCRs and antigens. Accordingly, extremely multiplexed dextramer-TCR binding assays have been just lately developed, however the utility of the following giant datasets is restricted by the shortage of sturdy computational strategies for normalization and interpretation.

Right here, we current a computational framework comprising a novel technique, ICON (Integrative COntext-specific Normalization), for figuring out dependable TCR-pMHC (peptide-major histocompatibility complicated) interactions and a neural network-based classifier TCRAI that outperforms different state-of-the-art strategies for TCR-antigen specificity prediction. We additional demonstrated that by combining ICON and TCRAI, we’re capable of uncover novel subgroups of TCRs that bind to a given pMHC through totally different mechanisms. Our framework facilitates the identification and understanding of TCR-antigen-specific interactions for fundamental immunological analysis and medical immune monitoring.

 

Quantifying persistence within the T-cell signaling community utilizing an optically controllable antigen receptor

T cells discriminate between wholesome and contaminated cells with outstanding sensitivity when mounting an immune response, which is hypothesized to rely on T cells combining stimuli from a number of antigen-presenting cell interactions right into a stronger response. To quantify the capability for T cells to perform this, we now have developed an antigen receptor that’s optically tunable inside cell conjugates, offering management over the length, and depth of intracellular T-cell signaling.

We observe restricted persistence inside the T-cell intracellular community on disruption of receptor enter, with indicators dissipating solely in ~15 min, and straight present sustained proximal receptor signaling is required to keep up gene transcription. T cells thus primarily accumulate the outputs of gene expression slightly than combine discrete intracellular indicators. Engineering optical management in a clinically related chimeric antigen receptor (CAR), we present that this restricted sign persistence will be exploited to extend CAR-T cell activation threefold utilizing pulsatile stimulation. Our outcomes are prone to apply extra typically to the signaling dynamics of different mobile networks.

Tumor rejection properties of gp100 ₂₀₉-specific T cells correlate with T cell receptor binding affinity in direction of the wild sort slightly than anchor-modified antigen

Though there are exceptions and outliers, T cell useful responses typically correlate with the affinity of a TCR for a peptide/MHC complicated. In a single just lately described outlier case, essentially the most promising medical candidate in a sequence of TCRs particular for the gp100₂₀₉ melanoma antigen certain with the weakest resolution affinity and produced the least quantity of cytokine in vitro. Hypotheses for this outlier conduct included uncommon cytokine expression patterns arising from an atypical TCR binding geometry. Learning this occasion in additional element, we discovered right here that outlier conduct is attributable to not uncommon cytokine patterns or TCR binding, however the usage of a place 2 anchor-modified peptide variant in in vitro experiments as an alternative of the wild sort antigen that’s current in vivo.

Though the anchor-modified variant has been extensively utilized in fundamental and medical immunology as a surrogate for the wild sort peptide, prior work has proven that TCRs can clearly distinguish between the 2. We present that when this differential recognition is accounted for, the useful properties of gp100₂₀₉-specific TCRs observe with their affinity in direction of the peptide/MHC complicated. Past demonstrating the correlates with T cell operate for a clinically related TCR, our outcomes present necessary concerns for choice of TCRs for immunotherapy and the usage of modified peptides in immunology.

CORNING® REUSABLE PHENOLIC GPI 28-400 THREADED SCREW CAP WITH RUBBER LINER
9999-28	CORNING	144/pk	EUR 240
Description: General Apparatus; Stoppers

Mouse pre-microRNA Expression Construct mir-28
MMIR-28-PA-1	SBI	Bacterial Streak	EUR 684
Category: MicroRNA Tools

EBAG9 antibody
70R-16981	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EBAG9 antibody

EBAG9 antibody
38323-100ul	SAB	100ul	EUR 252

EBAG9 Antibody
DF6703	Affbiotech	200ul	EUR 304
Description: EBAG9 Antibody detects endogenous levels of total EBAG9.

EBAG9 antibody
70R-9916	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal EBAG9 antibody

EBAG9 Antibody
1-CSB-PA007355GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EBAG9. Recognizes EBAG9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EBAG9 siRNA
20-abx901624	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EBAG9 siRNA
20-abx914879	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EBAG9 siRNA
20-abx914880	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EBAG9 Antibody
ABD6703	Lifescience Market	100 ug	EUR 438

EBAG9 protein (His tag)
80R-1093	Fitzgerald	100 ug	EUR 224
Description: Purified recombinant Human EBAG9 protein

CMV (Cytomegalovirus Antibody IgG) ELISA test
28	Biobase	96T/Box	Ask for price
Area of application: Prepotency testing
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgG)

RNU6-28 Recombinant Protein (Human)
RP089073	ABM	100 ug	Ask for price

Recombinant HPV-28 E1 Protein
VAng-Wyb3131-inquire	Creative Biolabs	inquire	Ask for price
Description: Human papillomavirus type 28 Replication protein E1, recombinant protein.

Recombinant HPV-28 L1 Protein
VAng-Wyb3136-inquire	Creative Biolabs	inquire	Ask for price
Description: Human papillomavirus type 28 Major capsid protein L1, recombinant protein.

EBAG9 Blocking Peptide
33R-2039	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBAG9 antibody, catalog no. 70R-9916

Human EBAG9 Antibody
32605-05111	AssayPro	150 ug	EUR 261

EBAG9 Blocking Peptide
DF6703-BP	Affbiotech	1mg	EUR 195

EBAG9 Conjugated Antibody
C38323	SAB	100ul	EUR 397

EBAG9 cloning plasmid
CSB-CL007355HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 642 Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga Show more
Description: A cloning plasmid for the EBAG9 gene.

EBAG9 cloning plasmid
CSB-CL007355HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 642 Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga Show more
Description: A cloning plasmid for the EBAG9 gene.

EBAG9 Rabbit pAb
A8385-100ul	Abclonal	100 ul	EUR 308

EBAG9 Rabbit pAb
A8385-200ul	Abclonal	200 ul	EUR 459

EBAG9 Rabbit pAb
A8385-20ul	Abclonal	20 ul	Ask for price

EBAG9 Rabbit pAb
A8385-50ul	Abclonal	50 ul	Ask for price

EBAG9 Rabbit pAb
A1935-100ul	Abclonal	100 ul	EUR 308

EBAG9 Rabbit pAb
A1935-200ul	Abclonal	200 ul	EUR 459

EBAG9 Rabbit pAb
A1935-20ul	Abclonal	20 ul	EUR 183

EBAG9 Rabbit pAb
A1935-50ul	Abclonal	50 ul	EUR 223

Anti-EBAG9 Antibody
PB9553	BosterBio	100ug/vial	EUR 334

pCMV-SPORT6-EBAG9
PVT13493	Lifescience Market	2 ug	EUR 391

Anti-EBAG9 antibody
STJ110683	St John's Laboratory	100 µl	EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.

Anti-EBAG9 antibody
STJ23462	St John's Laboratory	100 µl	EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.

Anti-EBAG9 (4A10)
YF-MA16699	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EBAG9

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-100ug
QP5959-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-10ug
QP5959-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-1mg
QP5959-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-200ug
QP5959-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-500ug
QP5959-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-50ug
QP5959-ec-50ug	EnQuireBio	50ug	EUR 263

IL-28, human recombinant
4978-1000	Biovision		EUR 5204

IL-28, human recombinant
4978-20	Biovision		EUR 294

Matrix Metalloproteinase-28 (Recombinant)
20-abx073425	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Recombinant Keratin 28 (KRT28)
4-RPS214Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: A6BLY7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 80.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Keratin 28 expressed in: E.coli

Recombinant Human Vacuolar Protein Sorting 28
7-06871	CHI Scientific	10µg	Ask for price

Recombinant Human Vacuolar Protein Sorting 28
7-06872	CHI Scientific	50µg	Ask for price

Recombinant Human Vacuolar Protein Sorting 28
7-06873	CHI Scientific	1mg	Ask for price

Polyclonal EBAG9 Antibody (Center)
APR04492G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:

Rat EBAG9 shRNA Plasmid
20-abx989010	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EBAG9 shRNA Plasmid
20-abx974569	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal EBAG9 Antibody (Center)
APR06938G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:

Human EBAG9 shRNA Plasmid
20-abx956064	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-EBAG9 / RCAS1 antibody
STJ70947	St John's Laboratory	100 µg	EUR 359

PRSS28 Protease Serine 28 Mouse Recombinant Protein
PROTQ924N9	BosterBio	Regular: 5ug	EUR 317
Description: PRSS28 Mouse Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 256 amino acids (27-274a.a.) and having a molecular mass of 28.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa)._x000D_PRSS28 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

MMP28 Matrix Metalloproteinase-28 Human Recombinant Protein
PROTQ9H239	BosterBio	Regular: 20ug	EUR 317
Description: MMP28 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 421 amino acids (123-520a.a) and having a molecular mass of 47.3kDa. MMP28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-100g	Creative Biolabs	100 µg	EUR 1013
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)

Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-1mg	Creative Biolabs	1 mg	EUR 6402
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)

Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-20g	Creative Biolabs	20 µg	EUR 594
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)

Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-50g	Creative Biolabs	50 µg	EUR 1013
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)

Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2577
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.

Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 1747
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.

Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1197
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.

Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-100g	Creative Biolabs	100 µg	EUR 7254
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)

Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-50g	Creative Biolabs	50 µg	EUR 4765
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)

Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-100g	Creative Biolabs	100 µg	EUR 1150
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)

Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-1mg	Creative Biolabs	1 mg	EUR 3913
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)

Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-500g	Creative Biolabs	500 µg	EUR 2663
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)

Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-1mg	Creative Biolabs	1 mg	EUR 3390
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)

Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-200g	Creative Biolabs	200 µg	EUR 1370
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)

Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-500g	Creative Biolabs	500 µg	EUR 2223
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)

Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-1mg	Creative Biolabs	1 mg	EUR 5852
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)

Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-500g	Creative Biolabs	500 µg	EUR 3583
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)

Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-500g	Creative Biolabs	500 µg	EUR 6415
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)

Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-50g	Creative Biolabs	50 µg	EUR 1246
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)

VPS28 Vacuolar Protein Sorting 28 Human Recombinant Protein
PROTQ9UK41	BosterBio	Regular: 50ug	EUR 317
Description: VPS28 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-221 a.a.) and having a molecular mass of 25.4kDa.;The VPS28 is purified by proprietary chromatographic techniques.

EBAG9 Protein Vector (Mouse) (pPB-C-His)
PV174238	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Mouse) (pPB-N-His)
PV174239	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Mouse) (pPM-C-HA)
PV174240	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Mouse) (pPM-C-His)
PV174241	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Rat) (pPB-C-His)
PV265294	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Rat) (pPB-N-His)
PV265295	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Rat) (pPM-C-HA)
PV265296	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Rat) (pPM-C-His)
PV265297	ABM	500 ng	EUR 603

EBAG9 Protein Vector (Human) (pPB-C-His)
PV013461	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPB-N-His)
PV013462	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013463	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPM-C-His)
PV013464	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPB-C-His)
PV013465	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPB-N-His)
PV013466	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013467	ABM	500 ng	EUR 329

EBAG9 Protein Vector (Human) (pPM-C-His)
PV013468	ABM	500 ng	EUR 329

Human EBAG9 Antibody (Biotin Conjugate)
32605-05121	AssayPro	150 ug	EUR 369

Ebag9 ORF Vector (Rat) (pORF)
ORF066324	ABM	1.0 ug DNA	EUR 506

EBAG9 ORF Vector (Human) (pORF)
ORF003366	ABM	1.0 ug DNA	EUR 95

EBAG9 ORF Vector (Human) (pORF)
ORF003367	ABM	1.0 ug DNA	EUR 95

Ebag9 ORF Vector (Mouse) (pORF)
ORF043560	ABM	1.0 ug DNA	EUR 506

EBAG9 ELISA Kit (Human) (OKCA02302)
OKCA02302	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.195 U/mL.

EBAG9 ELISA Kit (Human) (OKEH05822)
OKEH05822	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39U/L

TRIM28 Tripartite Motif Containing 28 Human Recombinant Protein
PROTQ13263	BosterBio	Regular: 20ug	EUR 317
Description: TRIM28 Human Recombinant produced in E. Coli is a single polypeptide chain containing 460 amino acids (366-802) and having a molecular mass of 48.7 kDa.;TRIM28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-1mg	Creative Biolabs	1 mg	EUR 2745
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)

Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-200g	Creative Biolabs	200 µg	EUR 793
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)

Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-1mg	Creative Biolabs	1 mg	EUR 2580
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)

Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-200g	Creative Biolabs	200 µg	EUR 738
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)

Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-1mg	Creative Biolabs	1 mg	EUR 4009
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)

Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-200g	Creative Biolabs	200 µg	EUR 985
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)

Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-100g	Creative Biolabs	100 µg	EUR 738
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)

Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-1mg	Creative Biolabs	1 mg	EUR 4009
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)

Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-1mg	Creative Biolabs	1 mg	EUR 5274
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)

Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-50g	Creative Biolabs	50 µg	EUR 848
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)

Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-200g	Creative Biolabs	200 µg	EUR 3844
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)

Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-25g	Creative Biolabs	25 µg	EUR 1013
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)

Recombinant Staphylococcus Aureus entB Protein (aa 28-266)
VAng-Cr5729-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 4793
Description: Staphylococcus Aureus Enterotoxin type B (entB), recombinant protein.

Recombinant Staphylococcus Aureus entB Protein (aa 28-266)
VAng-Cr5729-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 3048
Description: Staphylococcus Aureus Enterotoxin type B (entB), recombinant protein.

Recombinant Staphylococcus Aureus ENTC1 Protein (aa 28-266)
VAng-Cr5730-inquire	Creative Biolabs	inquire	Ask for price
Description: Staphylococcus Aureus Enterotoxin type C-1 (ENTC1), recombinant protein.

Recombinant Staphylococcus Aureus entC2 Protein (aa 28-266)
VAng-Cr5731-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2663
Description: Staphylococcus Aureus Enterotoxin type C-2 (entC2), recombinant protein.

Recombinant Staphylococcus Aureus entC2 Protein (aa 28-266)
VAng-Cr5731-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1810
Description: Staphylococcus Aureus Enterotoxin type C-2 (entC2), recombinant protein.

Recombinant Staphylococcus Aureus entE Protein (aa 28-257)
VAng-Cr5733-inquire	Creative Biolabs	inquire	Ask for price
Description: Staphylococcus Aureus Enterotoxin type E (entE), recombinant protein.

Recombinant Staphylococcus Aureus ssaA2 Protein (aa 28-267)
VAng-Cr6465-inquire	Creative Biolabs	inquire	Ask for price
Description: Staphylococcus Aureus (strain Mu50 / ATCC 700699) Staphylococcal secretory antigen ssaA2 (ssaA2), recombinant protein.

Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3473
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.

Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2484
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.

Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1686
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.

Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2814
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.

Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2016
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.

Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1398
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.

Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2649
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.

Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 1879
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.

Recombinant Trypanosoma Brucei PROA Protein (aa 28-93)
VAng-Wyb8152-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1301
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide protein, recombinant protein.

Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2940
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.

Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2109
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.

Recombinant Mycobacterium Bovis Mb2034c Protein (aa 28-143)
VAng-Yyj2888-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1454
Description: Mycobacterium Bovis Uncharacterized protein Mb2034c (Mb2034c), recombinant protein.

Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3432
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.

Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2456
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.

Recombinant Mycobacterium Bovis Mb1845 Protein (aa 28-221)
VAng-Yyj3040-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1673
Description: Mycobacterium Bovis Uncharacterized protein Mb1845 (Mb1845), recombinant protein.

Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 4614
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.

Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 3268
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.

Recombinant Mycobacterium Bovis Mb3815c Protein (aa 28-407)
VAng-Yyj3128-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 2236
Description: Mycobacterium Bovis Uncharacterized protein Mb3815c (Mb3815c), recombinant protein.

Recombinant Caenorhabditis Elegans F01G4.6 Protein (aa 28-340)
VAng-Ly3313-inquire	Creative Biolabs	inquire	Ask for price
Description: Caenorhabditis Elegans phosphate carrier protein, mitochondrial (F01G4.6), recombination protein.

Recombinant Mycobacterium Leprae lprB Protein (aa 28-188)
VAng-Yyj1725-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1594
Description: Mycobacterium Leprae Putative lipoprotein lprB (lprB), recombinant protein.

Recombinant Mycobacterium Tuberculosis Rv2011c Protein (aa 28-143)
VAng-Yyj0692-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1454
Description: Mycobacterium Tuberculosis Uncharacterized protein Rv2011c/MT2066 (Rv2011c, MT2066), recombinant protein.

Recombinant Mycobacterium Tuberculosis Rv3786c Protein (aa 28-407)
VAng-Yyj0754-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 2238
Description: Mycobacterium Tuberculosis Uncharacterized protein Rv3786c/MT3894 (Rv3786c, MT3894), recombinant protein.

Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 4587
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.

Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 3239
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.

Recombinant HPV-28 E2 (aa 1-376) Protein
VAng-Wyb3132-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 2209
Description: Human papillomavirus type 28 Regulatory protein E2, recombinant protein.

Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2840
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.

Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2030
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.

Recombinant HPV-28 E4 (aa 1-99) Protein
VAng-Wyb3133-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1398
Description: Human papillomavirus type 28 Probable protein E4, recombinant protein.

Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3129
Description: Human papillomavirus type 28 protein E6, recombinant protein.

Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2236
Description: Human papillomavirus type 28 protein E6, recombinant protein.

Recombinant HPV-28 E6 (aa 1-146) Protein
VAng-Wyb3134-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1549
Description: Human papillomavirus type 28 protein E6, recombinant protein.

Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 2785
Description: Human papillomavirus type 28 protein E7, recombinant protein.

Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 1975
Description: Human papillomavirus type 28 protein E7, recombinant protein.

Recombinant HPV-28 E7 (aa 1-87) Protein
VAng-Wyb3135-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1370
Description: Human papillomavirus type 28 protein E7, recombinant protein.

Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 5205
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.

Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 3679
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.

Recombinant HPV-28 L2 (aa 1-473) Protein
VAng-Wyb3137-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 2511
Description: Human papillomavirus type 28 Minor capsid protein L2, recombinant protein.

Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3736
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.

Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2530
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.

Recombinant Aeromonas Hydrophila dnsH Protein (aa 28-237)
VAng-Lsx0622-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1723
Description: Aeromonas Hydrophila Periplasmic deoxyribonuclease (aa 28-237), recombinant protein.

Recombinant Aeromonas Hydrophila cphA Protein (aa 28-254)
VAng-Lsx0640-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3829
Description: Aeromonas Hydrophila Aeromonas Hydrophila Beta-lactamase (aa 28-254), recombinant protein.

Proliferating cell nuclear antigen straight interacts with androgen receptor and enhances androgen receptor‑mediated signaling

Androgen receptor (AR) and/or its constitutively lively splicing variants (AR‑Vs), reminiscent of AR‑V7 and ARv567es, is required for prostate most cancers cell development and survival, and most cancers development. Proliferating cell nuclear antigen (PCNA) is preferentially overexpressed in all cancers and executes its capabilities by way of interplay with quite a few accomplice proteins. The goal of the current research was to research the potential position of PCNA within the regulation of AR exercise.

An equivalent consensus sequence of the PCNA‑interacting protein‑field (PIP‑field) was recognized on the N‑terminus of human, mouse and rat AR proteins. It was discovered that PCNA complexes with the total‑size AR (AR‑FL) and AR‑V7, which will be attenuated by the small molecule PIP‑field inhibitor, T2AA. PCNA additionally complexes with ARv567es and recombinant AR protein. The PCNA inhibitors, PCNA‑I1S and T2AA, inhibited AR transcriptional exercise and the expression of AR goal genes in LNCaP‑AI and 22Rv1 cells, however not in AR‑detrimental PC‑three cells. The knockdown of PCNA expression lowered dihydrotestosterone‑stimulated AR transcriptional exercise and abolished the inhibitory impact of PCNA‑I1S on AR exercise. The PCNA inhibitor, PCNA‑I1, exerted additive development inhibitory results with androgen deprivation and enzalutamide in cells expressing AR‑FL or AR‑FL/AR‑V7, however not in AR‑detrimental PC‑three cells.

Lastly, R9‑AR‑PIP, a small peptide mimicking AR PIP‑field, was discovered to bind to GFP‑PCNA at Ok_d of two.73 µM and inhibit the expression of AR goal genes, AR transcriptional exercise and the expansion of AR‑expressing cells. On the entire, these information strongly recommend that AR is a PCNA accomplice protein and interacts with PCNA through the PIP‑field and that focusing on the PCNA‑AR interplay might characterize an progressive and selective therapeutic technique towards prostate most cancers, notably castration‑resistant prostate cancers overexpressing constitutively lively AR‑Vs.

Novel high-affinity EGFRvIII-specific chimeric antigen receptor T cells successfully remove human glioblastoma

Targets: The rising success of Chimeric Antigen Receptor (CAR) T cell remedy in haematological malignancies is reinvigorating its software in lots of different most cancers varieties and with renewed concentrate on its software to strong tumors. We current a novel CAR towards glioblastoma, an aggressive, malignant glioma, with a dismal survival charge for which therapy choices have remained unchanged for over a decade.

Strategies: We use the human Retained Show (ReD) antibody platform (Myrio Therapeutics) to establish a novel single-chain variable fragment (scFv) that recognises epidermal development issue receptor mutant variant III (EGFRvIII), a typical and tumor-specific mutation present in glioblastoma. We use each in vitro useful assays and an in vivo orthotopic xenograft mannequin of glioblastoma to look at the operate of our novel CAR, known as GCT02, focused utilizing murine CAR T cells.

Outcomes: Our EGFRvIII-specific scFv was discovered to be of a lot increased affinity than reported comparators reverse-engineered from monoclonal antibodies. Regardless of the upper affinity, GCT02 CAR T cells kill equivalently however secrete decrease quantities of cytokine. As well as, GCT02-CAR T cells additionally mediate fast and full tumor elimination in vivo.

Conclusion: We current a novel EGFRvIII-specific CAR, with efficient antitumor capabilities each in in vitro and in a xenograft mannequin of human glioblastoma.

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723393	ABM	1.0 ug DNA	Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723399	ABM	1.0 ug DNA	Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723405	ABM	1.0 ug DNA	Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723411	ABM	1.0 ug DNA	Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723417	ABM	1.0 ug DNA	Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723423	ABM	1.0 ug DNA	Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723429	ABM	1.0 ug DNA	Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723435	ABM	1.0 ug DNA	Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723441	ABM	1.0 ug DNA	Ask for price

DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723447	ABM	1.0 ug DNA	Ask for price

DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723453	ABM	1.0 ug DNA	Ask for price

DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723459	ABM	1.0 ug DNA	Ask for price

DUX4L10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723465	ABM	1.0 ug DNA	Ask for price

DUX4L11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723471	ABM	1.0 ug DNA	Ask for price

DUX4L14 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723477	ABM	1.0 ug DNA	Ask for price

DUX4L16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723483	ABM	1.0 ug DNA	Ask for price

DUX4L17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723489	ABM	1.0 ug DNA	Ask for price

DUX4L18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723495	ABM	1.0 ug DNA	Ask for price

DUX4L19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723501	ABM	1.0 ug DNA	Ask for price

DUXB Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723507	ABM	1.0 ug DNA	Ask for price

DVL1L1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723513	ABM	1.0 ug DNA	Ask for price

DWS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723519	ABM	1.0 ug DNA	Ask for price

DYNLL1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723525	ABM	1.0 ug DNA	Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723531	ABM	1.0 ug DNA	Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723537	ABM	1.0 ug DNA	Ask for price

DYT2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723543	ABM	1.0 ug DNA	Ask for price

DYT4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723549	ABM	1.0 ug DNA	Ask for price

DYT7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723555	ABM	1.0 ug DNA	Ask for price

DYT10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723561	ABM	1.0 ug DNA	Ask for price

DYT13 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723567	ABM	1.0 ug DNA	Ask for price

DYT15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723573	ABM	1.0 ug DNA	Ask for price

DYT17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723579	ABM	1.0 ug DNA	Ask for price

DYT21 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723585	ABM	1.0 ug DNA	Ask for price

DYT22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723591	ABM	1.0 ug DNA	Ask for price

DYX1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723597	ABM	1.0 ug DNA	Ask for price

DYX2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723609	ABM	1.0 ug DNA	Ask for price

DYX3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723615	ABM	1.0 ug DNA	Ask for price

DYX4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723621	ABM	1.0 ug DNA	Ask for price

DYX5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723627	ABM	1.0 ug DNA	Ask for price

DYX6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723633	ABM	1.0 ug DNA	Ask for price

DYX7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723639	ABM	1.0 ug DNA	Ask for price

DYX8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723645	ABM	1.0 ug DNA	Ask for price

DYX9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723651	ABM	1.0 ug DNA	Ask for price

E2F3P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723663	ABM	1.0 ug DNA	Ask for price

E2F4P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723669	ABM	1.0 ug DNA	Ask for price

E11S Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723675	ABM	1.0 ug DNA	Ask for price

EBM Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723687	ABM	1.0 ug DNA	Ask for price

EBR3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723693	ABM	1.0 ug DNA	Ask for price

EBR4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723699	ABM	1.0 ug DNA	Ask for price

EBVM1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723705	ABM	1.0 ug DNA	Ask for price

EBVS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723711	ABM	1.0 ug DNA	Ask for price

ECA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723717	ABM	1.0 ug DNA	Ask for price

ECEL1P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723723	ABM	1.0 ug DNA	Ask for price

ECEL1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723729	ABM	1.0 ug DNA	Ask for price

EDDM3DP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723735	ABM	1.0 ug DNA	Ask for price

EEC1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723741	ABM	1.0 ug DNA	Ask for price

EEC2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723747	ABM	1.0 ug DNA	Ask for price

EEF1A1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723753	ABM	1.0 ug DNA	Ask for price

EEF1A1P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723759	ABM	1.0 ug DNA	Ask for price

EEF1A1P15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723765	ABM	1.0 ug DNA	Ask for price

EEF1A1P16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723771	ABM	1.0 ug DNA	Ask for price

EEF1A1P17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723777	ABM	1.0 ug DNA	Ask for price

EEF1A1P18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723783	ABM	1.0 ug DNA	Ask for price

EEF1A1P22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723789	ABM	1.0 ug DNA	Ask for price

EEF1A1P23 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723795	ABM	1.0 ug DNA	Ask for price

EEF1A1P25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723801	ABM	1.0 ug DNA	Ask for price

EEF1A1P26 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723807	ABM	1.0 ug DNA	Ask for price

EEF1A1P28 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723813	ABM	1.0 ug DNA	Ask for price

EEF1A1P29 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723819	ABM	1.0 ug DNA	Ask for price

EEF1A1P30 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723825	ABM	1.0 ug DNA	Ask for price

EEF1A1P31 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723831	ABM	1.0 ug DNA	Ask for price

EEF1A1P33 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723837	ABM	1.0 ug DNA	Ask for price

EEF1A1P34 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723843	ABM	1.0 ug DNA	Ask for price

EEF1A1P35 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723849	ABM	1.0 ug DNA	Ask for price

EEF1A1P38 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723855	ABM	1.0 ug DNA	Ask for price

EEF1A1P40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723861	ABM	1.0 ug DNA	Ask for price

EEF1A1P41 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723867	ABM	1.0 ug DNA	Ask for price

EEF1A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723873	ABM	1.0 ug DNA	Ask for price

EEF1B2P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723879	ABM	1.0 ug DNA	Ask for price

EEF1DP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723885	ABM	1.0 ug DNA	Ask for price

EEF1DP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723891	ABM	1.0 ug DNA	Ask for price

EEGV1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723897	ABM	1.0 ug DNA	Ask for price

EGI Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723933	ABM	1.0 ug DNA	Ask for price

EIF2AP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723951	ABM	1.0 ug DNA	Ask for price

EIF2AP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723957	ABM	1.0 ug DNA	Ask for price

EIF2AP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723963	ABM	1.0 ug DNA	Ask for price

EIF2AP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723969	ABM	1.0 ug DNA	Ask for price

EIF2S2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723987	ABM	1.0 ug DNA	Ask for price

EIF2S2P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723993	ABM	1.0 ug DNA	Ask for price

EIF2S2P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723999	ABM	1.0 ug DNA	Ask for price